Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3724481
End position: 3724508
Length: 28

DNA sequence
>NC_013410, from 3724481 to 3724508 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 TAGACGAAAGACGAGAGACGAAAGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3723988-3724620	Sequence	Fisuc_3025 - CMP/dCMP deaminase zinc-binding protein (Protein is coded in complementary strand; from 3724620 to 3723988)