Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 40316
End position: 40343
Length: 28

DNA sequence
>NC_013410, from 40316 to 40343 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 AGACGAGAGACGAGAGACGAGAGACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 39367-40410	Sequence	Fisuc_0038 - hypothetical protein (Protein is coded in complementary strand; from 40410 to 39367)