Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 572733
End position: 572760
Length: 28

DNA sequence
>NC_013410, from 572733 to 572760 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 GTTAGTGATTAGTGGTTGGTGGTTAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 571900-572733	Sequence	Fisuc_0496 - hypothetical protein (Protein is coded in complementary strand; from 572733 to 571900)