Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 605529
End position: 605556
Length: 28

DNA sequence
>NC_013410, from 605529 to 605556 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 TCTCTCGTCTCTCGTCCCTCGTCTCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 601683-605729	Sequence	Fisuc_0520 - helicase-associated domain-containing protein (Protein is coded in complementary strand; from 605729 to 601683)