Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 866810
End position: 866837
Length: 28

DNA sequence
>NC_013410, from 866810 to 866837 (28 bp); Fibrobacter succinogenes subsp. succinogenes S85 TCTTTCGTCTCTCGTCTCTCGTCTTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 866496-867878	Sequence	Fisuc_0725 - tRNA modification GTPase TrmE (Protein is coded in complementary strand; from 867878 to 866496)