Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2341518
End position: 2341552
Length: 35

DNA sequence
>NC_013410, from 2341518 to 2341552 (35 bp); Fibrobacter succinogenes subsp. succinogenes S85 TTAGAACTTAGAGCTTAGATCTTAGAACTTAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2340214-2341518	Sequence	Fisuc_1898 - hypothetical protein