Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2440693
End position: 2440727
Length: 35

DNA sequence
>NC_013410, from 2440693 to 2440727 (35 bp); Fibrobacter succinogenes subsp. succinogenes S85 ACTTCCTACTTCCGGCTTCCTACTTCCTACTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2440214-2441098	Sequence	Fisuc_1982 - glutamyl/glutaminyl-tRNA synthetase, class Ic, catalytic domain protein (Protein is coded in complementary strand; from 2441098 to 2440214)