Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2890250
End position: 2890284
Length: 35

DNA sequence
>NC_013410, from 2890250 to 2890284 (35 bp); Fibrobacter succinogenes subsp. succinogenes S85 TTCTAAGCTCTAAGTTCTGAGTACTAAGTTCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2890281-2891168	Sequence	Fisuc_2350 - Hsp33 protein (Protein is coded in complementary strand; from 2891168 to 2890281)