Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3164568
End position: 3164602
Length: 35

DNA sequence
>NC_013410, from 3164568 to 3164602 (35 bp); Fibrobacter succinogenes subsp. succinogenes S85 TGTCGTCTCTCGTCTTTCGTCTCTCGTCTTTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3164216-3165076	Sequence	Fisuc_2563 - pseudouridine synthase (Protein is coded in complementary strand; from 3165076 to 3164216)