Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3431452
End position: 3431486
Length: 35

DNA sequence
>NC_013410, from 3431452 to 3431486 (35 bp); Fibrobacter succinogenes subsp. succinogenes S85 GAGACGAAAGACGAGAGACGAGAGACGAGAGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3431164-3432345	Sequence	Fisuc_2779 - tRNA(Ile)-lysidine synthetase (Protein is coded in complementary strand; from 3432345 to 3431164)