Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2547005
End position: 2547040
Length: 36

DNA sequence
>NC_013410, from 2547005 to 2547040 (36 bp); Fibrobacter succinogenes subsp. succinogenes S85 TTTTCTGTAACCTTTTCTGTAACCTTTTCTGTAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2546831-2548306	Sequence	Fisuc_2063 - transcriptional regulator (Protein is coded in complementary strand; from 2548306 to 2546831)