Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2825382
End position: 2825417
Length: 36

DNA sequence
>NC_013410, from 2825382 to 2825417 (36 bp); Fibrobacter succinogenes subsp. succinogenes S85 CTGCCGCACCTGCTCCCGCACCAGCTGCAGCACCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2824893-2828003	Sequence	Fisuc_2296 - translation initiation factor IF-2