Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3197618
End position: 3197653
Length: 36

DNA sequence
>NC_013410, from 3197618 to 3197653 (36 bp); Fibrobacter succinogenes subsp. succinogenes S85 TGTTCAAGTCCCTGTTTAAGCCCCTGTTTAAGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3197474-3198508	Sequence	Fisuc_2582 - hypothetical protein (Protein is coded in complementary strand; from 3198508 to 3197474)