Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2799312
End position: 2799353
Length: 42

DNA sequence
>NC_013410, from 2799312 to 2799353 (42 bp); Fibrobacter succinogenes subsp. succinogenes S85 GTTAGAACTTAGAACTTAGAACTTAGAACTTAGAACTTAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2798556-2799317	Sequence	Fisuc_2273 - Fmu (Sun) domain-containing protein