Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2997030
End position: 2997071
Length: 42

DNA sequence
>NC_013410, from 2997030 to 2997071 (42 bp); Fibrobacter succinogenes subsp. succinogenes S85 TTTAGAACTTAGAACTTAGAGCTTAGAACTTAGAGCTTAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2995663-2997030	Sequence	Fisuc_2426 - Fis family transcriptional regulator (Protein is coded in complementary strand; from 2997030 to 2995663)