Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 1063843
End position: 1063887
Length: 45

DNA sequence
>NC_013410, from 1063843 to 1063887 (45 bp); Fibrobacter succinogenes subsp. succinogenes S85 TCTTCACAGAATCAGTCTTGACGGAATCCGTCTTAGCGGAATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1061772-1064384	Sequence	Fisuc_0858 - protein-export membrane protein SecD (Protein is coded in complementary strand; from 1064384 to 1061772)