Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 233441
End position: 233485
Length: 45

DNA sequence
>NC_013410, from 233441 to 233485 (45 bp); Fibrobacter succinogenes subsp. succinogenes S85 TTTCTTTTCAACCTTCTTCTTTTCAACCGTTTTCTTTGCGACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 233058-233990	Sequence	Fisuc_0199 - hypothetical protein (Protein is coded in complementary strand; from 233990 to 233058)