Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3675967
End position: 3676011
Length: 45

DNA sequence
>NC_013410, from 3675967 to 3676011 (45 bp); Fibrobacter succinogenes subsp. succinogenes S85 CTGCAACAGGAGCCGGAGCAACGGGAGCCGTTTCAACAGGAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3675084-3676076	Sequence	Fisuc_2982 - hypothetical protein (Protein is coded in complementary strand; from 3676076 to 3675084)