Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 1362549
End position: 1362596
Length: 48

DNA sequence
>NC_013410, from 1362549 to 1362596 (48 bp); Fibrobacter succinogenes subsp. succinogenes S85 TTTTTACAGTCGGATTTACAGTCGCCTTTACAGTCGGGTTTACAGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1362362-1363786	Sequence	Fisuc_1106 - transcriptional regulator (Protein is coded in complementary strand; from 1363786 to 1362362)