Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 2799313
End position: 2799361
Length: 49

DNA sequence
>NC_013410, from 2799313 to 2799361 (49 bp); Fibrobacter succinogenes subsp. succinogenes S85 TTAGAACTTAGAACTTAGAACTTAGAACTTAGAACTTAGAACTTAGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2798556-2799317	Sequence	Fisuc_2273 - Fmu (Sun) domain-containing protein