Sequence retrieval

Genome: Fibrobacter succinogenes subsp. succinogenes S85
Start position: 3358505
End position: 3358567
Length: 63

DNA sequence
>NC_013410, from 3358505 to 3358567 (63 bp); Fibrobacter succinogenes subsp. succinogenes S85 AAGTAGAGTTTAGAACTTAGAGTTTAGAGCTTAGAACTTAGAACTTAGAACTTAGAACTTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3358008-3358511	Sequence	Fisuc_2719 - hypothetical protein