Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 1625765
End position: 1625788
Length: 24

DNA sequence
>NC_013456, from 1625765 to 1625788 (24 bp); Vibrio sp. Ex25 GACCTTGACCTTGACCTTGACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1625713-1628058	Sequence	VEA_003066 - hypothetical protein (Protein is coded in complementary strand; from 1628058 to 1625713)