Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 175953
End position: 175976
Length: 24

DNA sequence
>NC_013456, from 175953 to 175976 (24 bp); Vibrio sp. Ex25 AAATAAAAAAATAAAGAAAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 175303-176565	Sequence	VEA_001786 - phosphoribosylamine-glycine ligase (Protein is coded in complementary strand; from 176565 to 175303)