Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 2326056
End position: 2326079
Length: 24

DNA sequence
>NC_013456, from 2326056 to 2326079 (24 bp); Vibrio sp. Ex25 CTGCTTTTGCTTCTTCTTCTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2325787-2326176	Sequence	VEA_003715 - translation initiation factor 3 (Protein is coded in complementary strand; from 2326176 to 2325787)