Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 2615876
End position: 2615902
Length: 27

DNA sequence
>NC_013456, from 2615876 to 2615902 (27 bp); Vibrio sp. Ex25 CACCACCGCCGCCACCGCCACCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2614489-2615964	Sequence	VEA_003974 - 54K polar flagellar sheath protein A (Protein is coded in complementary strand; from 2615964 to 2614489)