Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 564508
End position: 564534
Length: 27

DNA sequence
>NC_013456, from 564508 to 564534 (27 bp); Vibrio sp. Ex25 TTACGCAGTTTACGCAGAGTACGCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 563464-565740	Sequence	VEA_002147 - glycerol-3-phosphate acyltransferase (Protein is coded in complementary strand; from 565740 to 563464)