Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 70659
End position: 70685
Length: 27

DNA sequence
>NC_013456, from 70659 to 70685 (27 bp); Vibrio sp. Ex25 CATCACCACCGTCACCACCATCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 69617-70792	Sequence	VEA_001671 - GTP-binding protein Obg (Protein is coded in complementary strand; from 70792 to 69617)