Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 960541
End position: 960568
Length: 28

DNA sequence
>NC_013456, from 960541 to 960568 (28 bp); Vibrio sp. Ex25 ATTAGTGATTAGTGATTAGTGATTAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 960564-961796	Sequence	VEA_002479 - D-3-phosphoglycerate dehydrogenase (Protein is coded in complementary strand; from 961796 to 960564)