Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 639705
End position: 639749
Length: 45

DNA sequence
>NC_013456, from 639705 to 639749 (45 bp); Vibrio sp. Ex25 CTGGAGCTTCTGCTGCTGGCGCTTCTGCTACTGGTGCCGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 639455-639919	Sequence	VEA_002197 - acetyl-CoA carboxylase (Protein is coded in complementary strand; from 639919 to 639455)