Sequence retrieval

Genome: Vibrio sp. Ex25
Start position: 491103
End position: 491151
Length: 49

DNA sequence
>NC_013456, from 491103 to 491151 (49 bp); Vibrio sp. Ex25 TTTCTAGCTTCTAGCTTCTAGCTTCTAGCTTCTAGTTTCTAGCTTCTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 491149-492843	Sequence	VEA_002078 - Xaa-Pro aminopeptidase (Protein is coded in complementary strand; from 492843 to 491149)