Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 1097446
End position: 1097472
Length: 27

DNA sequence
>NC_013656, from 1097446 to 1097472 (27 bp); Lactococcus lactis subsp. lactis KF147 GGGAAAGATGGTAAAGATGGAAAAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1095314-1098328	Sequence	LLKF_1083 pp154 phage receptor-binding protein