Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 1190452
End position: 1190475
Length: 24

DNA sequence
>NC_013656, from 1190452 to 1190475 (24 bp); Lactococcus lactis subsp. lactis KF147 GTTGAACTTGAATTTGAAGATGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1189439-1190674	Sequence	LLKF_1177 clpX ATP-dependent endopeptidase Clp ATP-binding subunit ClpX