Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 1462645
End position: 1462668
Length: 24

DNA sequence
>NC_013656, from 1462645 to 1462668 (24 bp); Lactococcus lactis subsp. lactis KF147 ATTAGCATTAGCATTAGCATTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1460531-1465471	Sequence	LLKF_1399 csc1C WxL domain-containing cell surface protein (Protein is coded in complementary strand; from 1465471 to 1460531)