Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 1921205
End position: 1921229
Length: 25

DNA sequence
>NC_013656, from 1921205 to 1921229 (25 bp); Lactococcus lactis subsp. lactis KF147 TTTTTTTTATTTTATTATTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1920100-1921248	Sequence	LLKF_1856 - transcriptional regulator (Protein is coded in complementary strand; from 1921248 to 1920100)