Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 2123502
End position: 2123537
Length: 36

DNA sequence
>NC_013656, from 2123502 to 2123537 (36 bp); Lactococcus lactis subsp. lactis KF147 TGTTTCTGTTTCTGTTTCTGTTTCTGTTTCTGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2123263-2124213	Sequence	LLKF_2057 divIVA cell division initiation protein divIVA (Protein is coded in complementary strand; from 2124213 to 2123263)