Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 2327237
End position: 2327266
Length: 30

DNA sequence
>NC_013656, from 2327237 to 2327266 (30 bp); Lactococcus lactis subsp. lactis KF147 TCACTTGATTTCATTTGATTTGACTTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2326051-2327241	Sequence	LLKF_2266 galK galactokinase (Protein is coded in complementary strand; from 2327241 to 2326051)
ORF... 2327238-2329454	Sequence	LLKF_2267 aga alpha-galactosidase (Protein is coded in complementary strand; from 2329454 to 2327238)