Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 2460918
End position: 2460953
Length: 36

DNA sequence
>NC_013656, from 2460918 to 2460953 (36 bp); Lactococcus lactis subsp. lactis KF147 TTTTTTCTTCTTGTTTTTCTTCTCTTTTTTCTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2460344-2461483	Sequence	LLKF_2404 - MF superfamily transporter (Protein is coded in complementary strand; from 2461483 to 2460344)