Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 2570968
End position: 2570991
Length: 24

DNA sequence
>NC_013656, from 2570968 to 2570991 (24 bp); Lactococcus lactis subsp. lactis KF147 CTTTTTCTATTTCTTCTTCTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2570769-2571269	Sequence	LLKF_2517 yxdD TetR family transcriptional regulator (Protein is coded in complementary strand; from 2571269 to 2570769)