Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 431662
End position: 431685
Length: 24

DNA sequence
>NC_013656, from 431662 to 431685 (24 bp); Lactococcus lactis subsp. lactis KF147 TTTTTATTTTAATTTTTATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 431671-433713	Sequence	LLKF_0434 nhaP NhaP-type Na+/H+ and K+/H+ antiporter (Protein is coded in complementary strand; from 433713 to 431671)