Sequence retrieval

Genome: Lactococcus lactis subsp. lactis KF147
Start position: 906898
End position: 906921
Length: 24

DNA sequence
>NC_013656, from 906898 to 906921 (24 bp); Lactococcus lactis subsp. lactis KF147 AAATAAAAAAATAGAAATATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 906047-906904	Sequence	LLKF_0877 ispA dimethylallyltransferase/geranyltranstransferase