Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 205431
End position: 205454
Length: 24

DNA sequence
>NC_013739, from 205431 to 205454 (24 bp); Conexibacter woesei DSM 14684 CGAGCGCGACCGCGACCGCGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 205265-205603	Sequence	Cwoe_0203 - hypothetical protein (Protein is coded in complementary strand; from 205603 to 205265)