Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 300035
End position: 300058
Length: 24

DNA sequence
>NC_013739, from 300035 to 300058 (24 bp); Conexibacter woesei DSM 14684 GACGACGACGAGGATGACGACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 299745-301106	Sequence	Cwoe_0292 - integral membrane sensor signal transduction histidine kinase