Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 763301
End position: 763324
Length: 24

DNA sequence
>NC_013739, from 763301 to 763324 (24 bp); Conexibacter woesei DSM 14684 GGCGACGGCGACGGTGACGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 762816-764207	Sequence	Cwoe_0719 - integral membrane sensor signal transduction histidine kinase