Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 381519
End position: 381545
Length: 27

DNA sequence
>NC_013739, from 381519 to 381545 (27 bp); Conexibacter woesei DSM 14684 CGACGCGACCGTCGCGACGGACGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 380899-381651	Sequence	Cwoe_0372 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 381651 to 380899)