Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 544042
End position: 544068
Length: 27

DNA sequence
>NC_013739, from 544042 to 544068 (27 bp); Conexibacter woesei DSM 14684 CTGCCGGCGCCGCCGGCGCCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 543853-545115	Sequence	Cwoe_0522 - hypothetical protein (Protein is coded in complementary strand; from 545115 to 543853)