Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5062750
End position: 5062779
Length: 30

DNA sequence
>NC_013739, from 5062750 to 5062779 (30 bp); Conexibacter woesei DSM 14684 CGCCGCACGCCGGCGCGCGCCGCCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5062174-5063073	Sequence	Cwoe_4745 - NAD-dependent epimerase/dehydratase (Protein is coded in complementary strand; from 5063073 to 5062174)