Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6305799
End position: 6305828
Length: 30

DNA sequence
>NC_013739, from 6305799 to 6305828 (30 bp); Conexibacter woesei DSM 14684 GCAGCGGTCATCGGCGGTCAGCAGCGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6305590-6306171	Sequence	Cwoe_5893 - phosphoribosyltransferase (Protein is coded in complementary strand; from 6306171 to 6305590)