Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4211664
End position: 4211699
Length: 36

DNA sequence
>NC_013739, from 4211664 to 4211699 (36 bp); Conexibacter woesei DSM 14684 CGACCTTCTCGCCGACCTTGCCGCCGAGCTTCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4211027-4212304	Sequence	Cwoe_3970 - extracellular ligand-binding receptor (Protein is coded in complementary strand; from 4212304 to 4211027)