Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 2089779
End position: 2089823
Length: 45

DNA sequence
>NC_013739, from 2089779 to 2089823 (45 bp); Conexibacter woesei DSM 14684 GCGGTCCGTCCGGGGGCGGTCTGGCCTGGGGCGGTCCCGCCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2089380-2089988	Sequence	Cwoe_1988 - hypothetical protein (Protein is coded in complementary strand; from 2089988 to 2089380)