Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 1022946
End position: 1022972
Length: 27

DNA sequence
>NC_013739, from 1022946 to 1022972 (27 bp); Conexibacter woesei DSM 14684 AGCACGGCGAGCACCGCGAGCCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1022346-1023917	Sequence	Cwoe_0979 - O-antigen polymerase (Protein is coded in complementary strand; from 1023917 to 1022346)